Skip to main content

Table 1 Specific primer sequences to detect gene expression in llama in granulosa cells

From: The effect of seminal plasma β-NGF on follicular fluid hormone concentration and gene expression of steroidogenic enzymes in llama granulosa cells

Gene ID 5′-3’ Length (bp) product (bp)
3-beta-hydroxy steroid dehydrogenase (HSD3B) LL-HSD3B-F TGGTGGGCTTCTTGCTTAGT 20 174
LL-HSD3B-R CAACCCATTCCGTGGTATTC 20
Steroidogenic acute regulatory protein (StAR) LL-STAR-F GAATGGGGACGAAGTGCTAA 20 200
LL-STAR-R GCTCATGGGTGATGACTGTG 20
Side-Chain cleavage enzyme (p450scc) LL-p450scc-F GCCACTGCTCTTCCTGTCAT 20 237
LL-p450scc-R GCCATTTATTGCCTTCATGG 20
Aromatase (p450 Arom) LL-p450arom-F GTGTCCGGAGTGTGCCTGTT 21 148
LL-p450arom-R GGAACCTGCAGTGGGAAATGA 21
Vascular endothelial growth factor (VEGF) LL-VEGF-F TCCAATCGAGACCCTGGTAG 20 168
LL-VEGF-R ATCCGCATAATCTGCATGGT 20
Large ribosomal protein (RPLP0) rplp0-F GGCGACCTGGAAGTCCAACT 20 149
rplp0-R CCATCAGCACCACAGCCTTC 20