Skip to main content

Table 3 Qiagen primer assays used for quantification of miRNAs

From: Analyses of bovine luteal fractions obtained by FACS reveals enrichment of miR-183-96-182 cluster miRNAs in endothelial cells

miRNA Product code miRNA sequence (5′-3′)
hsa-miR-132 -3p/bta-miR-132 MS00003458 UAACAGUCUACAGCCAUGGUCG
hsa-miR-212 -3p MS00003815 UAACAGUCUCCAGUCACGGCC
hsa-miR-182-5p/bta-miR-182 MS00008855 UUUGGCAAUGGUAGAACUCACACU
hsa-miR-183-5p/bta-miR-183 MS00031507 UAUGGCACUGGUAGAAUUCACUG
hsa-miR-96-5p/bta-miR-96 MS00003360 UUUGGCACUAGCACAUUUUUGCU
RNU6–2 MS00033740 CGCTTCGGCAGCACATATACTA