Skip to main content

Table 2 Primer pair sequences used for qPCR

From: Analyses of bovine luteal fractions obtained by FACS reveals enrichment of miR-183-96-182 cluster miRNAs in endothelial cells

Genes   Sequence (5′-3′) Amplicon length (bp)
18S FW GCTGGCACCAGACTTG 209
RV GGGGAATCAGGGTTCG
Bovine- HSD3B1 FW GCGTTTCTCAGTGCTCAGATTT 195
RV TCAGCTTGATCTTGCTCTGGA
Bovine- CD144 FW ACAGGGACACCTTCACCATC 85
RV ATGCGTTCATAGTCCAGGGG