Skip to main content

Table 1 Sequences of primers used

From: Adipocyte alterations in endometriosis: reduced numbers of stem cells and microRNA induced alterations in adipocyte metabolic gene expression

HSL TGCTAGGCACATAGCCTCCT GCTGGGCTATGGGTGTCTTT NM_005357.3
CEBPA GCAAACTCACCGCTCCAATG CTTCTCTCATGGGGGTCTGC NM_004364.4
CEBPB GCCGGTTTCGAAGTTGATGC TTACACGTGGGTTGCGTCAG NM_005194.3
Leptin TGCGGATTCTTGTGGCTTTG CTGACTGCGTGTGTGAAATGT NM_000230.2
ADIPOQ TTCCATACCAGAGGGGCTCA CCCTTGAGTCGTGGTTTCCT NM_004797.3
PPARG CCGTGGCCGCAGAAATGAC CACGGAGCTGATCCCAAAGT NM_005037.5
ADIPONECTIN TTCCATACCAGAGGGGCTCA GAGTCGTGGTTTCCTGGTCA NM_001177800
IL6 ACCCCCAGGAGAAGATTCCA GTCTTCCCCCACACCAAGTT NM_000600
β-actin GAAGATCAAGATCATTGCTC AACGCAACTAAGTCATAGT NM_001101