Skip to main content

Table 1 Primers used in real-time RT-PCR

From: Profile of melatonin and its receptors and synthesizing enzymes in cumulus–oocyte complexes of the developing sheep antral follicle—a potential estradiol-mediated mechanism

Genes Primer sequences (5′-3′) Length (bp) Accession No.
HIOMT F: GCTGTACTCGCTGAACATGC 141 NM_001306120.1
R: CTGCCCAAGACTGCATCGTA
AANAT F: CCCCCTGAATCTGGACGAG 108 NM_001009461.1
R: CACAGGGAGCCGATGATGAAGG
MT1 F: GGTGTTCCATTTCATAGTTCC 169 NM_001009725.1
R: GGCAAAGAGGACAAAAACC
MT2 F: AGGTCAAGGCGGAGAGC 148 NM_001130938.1
R: GCCACTTCTTCGGGGTCAA
β-actin F: CTTCCAGCCTTCCTTCCTGG 180 NM_001009784.2
R: GCCAGGGCAGTGATCTCTTT