Skip to main content

Table 1 Specific primers used for real-time quantitative PCR

From: The effects of vitamin D supplementation on metabolic profiles and gene expression of insulin and lipid metabolism in infertile polycystic ovary syndrome candidates for in vitro fertilization

Gene Primer Product size (bp) Annealing temperature ©
GAPDH F: AAGCTCATTTCCTGGTATGACAACG 126 61.3
R: TCTTCCTCTTGTGCTCTTGCTGG
PPAR-γ F: ATGACAGACCTCAGACAGATTG 210 54
R: AATGTTGGCAGTGGCTCAG   
GLUT-1 F: TATCTGAGCATCGTGGCCAT 238 62.1
R: AAGACGTAGGGACCACACAG   
LDLR F: ACTTACGGACAGACAGACAG 223 57
R: GGCCACACATCCCATGATTC   
  1. GAPDH glyceraldehyde-3-Phosphate dehydrogenase, GLUT-1 glucose transporter 1, LDLR low-density lipoprotein receptor, PPAR-γ peroxisome proliferator-activated receptor gamma