Skip to main content

Table 1 Primer sequence for reverse transcription PCR

From: Peroxiredoxin I maintains luteal function by regulating unfolded protein response

Target Accession numbers Primer Sequence reported 5′-3′ Tm°C length (bp)
3β-hsd NM_008293.3 Forward:5’ ACTGCAGGAGGTCAGAGCT 55 401
Prdx1 NM_011034.4 Forward:5’ CACCCAAGAAACAAGGAGGA 53.5 343
Star NM_011485.4 Forward:5’ GAAAAGACACGGTCATCACT 56 262
AF195119.1 Forward:5’ GCTGGAAGGTGTAGCTCAGG 57 224
Gapdh BC145810.1 Forward:5’ ACCACAGTCCATGCCATCAC 55 452
  1. 3β-hsd: 3β-hydroxysteroid dehydrogenase, Prdx1: peroxiredoxin 1, Star: steroidogenesis acute regulatory, P450scc: cytochrome P450 side-chain cleavage, Tm: melting temperature