Skip to main content

Advertisement

Table 2 The list of top 10 most abundant novel miRNAs expressed in cryptorchid and normal tissues

From: Altered miRNA profile in testis of post-cryptorchidopexy patients with non-obstructive azoospermia

Cryptorchid tissues
miRNA ID Mature Sequence Reads count Location of novel miRNA precusor
chrX_47246 AUUGACACUUCUGUGAGUAGA 2,280,438 chrX:146366172..146366230:-
chr12_27425 UUCAAGUAAUCCAGGAUAGGCU 826,714 chr12:58218403..58218462:-
chr3_5958 UUCAAGUAAUCCAGGAUAGGCU 826,558 chr3:38010903..38010964:+
chr21_44054 AACCCGUAGAUCCGAUCUUGU 693,017 chr21:17911420..17911480:+
chrX_47235 UACUGCAGACGUGGCAAUCAUG 592,879 chrX:146341178..146341235:-
chr10_23103 UUCCUAUGCAUAUACUUCUUU 586,995 chr10:135061041..135061097:-
chr5_9937 UGAGAUGAAGCACUGUAGCUC 534,462 chr5:148808506..148808561:+
chr2_3766 UACCCUGUAGAACCGAAUUUGU 428,617 chr2:177015056..177015117:+
chrX_47228 UGAUUGUAGCCUUUUGGAGUAGA 298,225 chrX:146318462..146318520:-
chr3_7283 UGAGGUAGUAGUUUGUACAGUU 295,643 chr3:52302295..52302373:-
Normal tissues
miRNA ID Mature Sequence Reads count Location of novel miRNA precusor
chrX_47246 AUUGACACUUCUGUGAGUAGA 996,346 chrX:146366172..146366230:-
chr5_9937 UGAGAUGAAGCACUGUAGCUC 419,103 chr5:148808506..148808561:+
chr12_27425 UUCAAGUAAUCCAGGAUAGGCU 405,817 chr12:58218403..58218462:-
chr3_5958 UUCAAGUAAUCCAGGAUAGGCU 405,621 chr3:38010903..38010964:+
chrX_47235 UACUGCAGACGUGGCAAUCAUG 391,755 chrX:146341178..146341235:-
chr21_44054 AACCCGUAGAUCCGAUCUUGU 340,009 chr21:17911420..17911480:+
chr2_3766 UACCCUGUAGAACCGAAUUUGU 248,236 chr2:177015056..177015117:+
chr10_23103 UUCCUAUGCAUAUACUUCUUU 246,558 chr10:135061041..135061097:-
chr9_18744 UGAGGUAGUAGAUUGUAUAGUU 154,925 chr9:96938634..96938712:+
chr3_7283 UGAGGUAGUAGUUUGUACAGUU 151,154 chr3:52302295..52302373:-