Skip to main content

Table 1 Primer sequences for real-time reverse transcription–polymerase chain reaction

From: Docosahexaenoic acid (DHA) effects on proliferation and steroidogenesis of bovine granulosa cells

Abbrev. Gene Accession no. Forward primer Reverse primer bp E %
FFAR4 Free fatty acid receptor 4 XM_865266 GGGTTCCTTTTCGATGTGAA GCCGTGACTCTTTGGAGAAG 166 94
GPX4 Glutathione peroxidase 4 NM_174770 CGATACGCCGAGTGTGGTTTAC ACAGCCGTTCTTGTCAATGAGG 261 96
GLUT1 Solute carrier family 2 (facilitated glucose transporter), member 1 NM_174602 CTGATCCTGGGTCGCTTCAT ACGTACATGGGCACAAAACCA 68 113
NFkB Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 NM_001076409.1 GCACCACTTATGACGGGACT CCATGTCCAGAGGAGTGGTT 195 89
PPARA Peroxisome proliferator-activated receptor alpha NM_001034036.1 CCTACGGGAATGGCTTCATA GCACAATACCCTCCTGCATT 219 97
PPARG Peroxisome proliferator-activated receptor gamma Y12419/Y12420 CCCTGGCAAAGCATTTGTAT ACTGACACCCCTGGAAGATG 222 88
RPL19 Ribosomal protein L19 BC102223 AATCGCCAATGCCAACTC CCCTTTCGCTTACCTATACC 156 94
RPS9 Ribosomal protein S9 BC148016 GGAGACCCTTCGAGAAGTCC GGGCATTACCTTCGAACAGA 180 100
SREBF1 Sterol regulatory element binding transcription factor 1 AB355703.1 ACCGCTCTTCCATCAATGAC TTCAGCGATTTGCTTTTGTG 190 97
  1. Abbrev gene abbreviation, bp product size in base pair, E primer efficiency