Skip to main content

Table 1 Primer sequences of rat targeted genes

From: GnRH dysregulation in polycystic ovarian syndrome (PCOS) is a manifestation of an altered neurotransmitter profile

Targeted Genes Primer sequence Accession number
GnRH1 F: 5’ CCGCTGTTGTTCTGTTGACTG 3′
R: 5’ TCACACTCGGATGTTGTGGA 3′
NM_012767
GnRHR F: 5’ TCTGCAATGCCAAAATCATC 3′
R: 5’ GTAGGGAGTCCAGCAGATGAC 3′
NM_031038.3
FSHβ F: 5’ AGGAAGAGTGCCGTTTCTGC 3′
R: 5’ GCTGTCACTATCACACTTGC 3′
NM_001007597.2
LHβ F: 5’ CTGTCCTAGCATGGTTCGAGT 3′
R: 5’ AGTTAGTGGGTGGGCATCAG 3′
NM_012858.2
TH F: 5’ CATTGGACTTGCATCTCTGG 3′
R: 5’ GTTCCTGAGCTTGTCCTTGG 3′
NM_012740.3
COMT F: 5’ GACGCGAAAGGCCAAATCAT 3′
R: 5’ ACGTTGTCAGCTAGGAGCA 3′
NM_012531.2
5HT1A F:5’CCCCCCAAGAAGAGCCTGAA3′
R:5’GGCAGCCAGCAGAGGATGAA3′
NM_012585.1
α1AR F: 5’ ACCAGCTCCGGTGAACATTT 3′
R: 5’ GCCGCCCAGATATTGCAGAA 3′
NM_017191.2
D2R F:5’ TGAACCTGTGTGCCATCAGCA 3′
R:5’ TTGGCTCTGAAAGCTCGACTG 3′
NM_012547.1
GABAB1 F:5’CGCTACCATCCAACAGACCA3′
R:5’TGTCAGCATACCACCCGATG3′
NM_031028.3
M2-AchR F:5’CACAGTTTCCACTTCGCTGG 3′
R:5’ CACCTTTTTGGGCCTTGGTG 3′
NM_031016.1
NMDAR F:5’ ACACCGACCAAGAAGCCATC 3′
R:5’ GGACTCATCCTTATCCGCCA 3
NM_012574.1
β-Actin F: 5’ AGGCCCCTCTGAACCCTAAG 3′
R: 5’ GGAGCGCGTAACCCTCATAG 3′
NM_031144.3