Skip to main content

Table 1 Gene specific primers used in quantitative Real-Time PCR

From: Lactate promotes specific differentiation in bovine granulosa cells depending on lactate uptake thus mimicking an early post-LH stage

Gene dir Sequence Size (bp) Accession No.
RPLP0 for TGGTTACCCAACCGTCGCATCTGTA 142 NM_001012682
  rev CACAAAGGCAGATGGATCAGCCAAG   
CYP19A1 for GCTTTTGGAAGTGCTGAACCCAAGG 172 NM_174305
  rev GGGCCCAATTCCCAGAAAGTAGCTG   
FSHR for TCACCAAGCTTCGAGTCATCCCAAA 189 NM_174061
  rev TCTGGAAGGCATCAGGGTCGATGTA   
LHCGR for GCATCCACAAGCTTCCAGATGTTACGA 205 NM_174381
  rev GGGAAATCAGCGTTGTCCCATTGA   
RGS2 for AAGCCCAGCTGTGGTCAGAAGCATT 127 NM_001075596
  rev TCTTCACAGGCCAGCCAGAATTCAA   
VNN2 for TCCCACAGCTTGGATGAACGTTTTG 267 NM_001163920
  rev TAGGCACTCCAATTCATGGCTGGTG   
PTX3 for TTTGTGCGCTCTGGTCTGCAGTGT 164 NM_001076259
  rev CATGGTGAAGAGCTTGTCCCACTCG   
LDHA for GGGTTGGTGCTGTTGGCATGGCCT 232 NM_174099.2
  rev TCTCCCTCTTGCTGACGTGCCCCA   
SLC16A1 for GGTGGAGGTCCTATCAGCAGTGTCCT 236 NM_001037319.1
  rev AGTCCATTTGCCAGCGGTCGTCTC   
SLC16A7 for ACCCAGTGCCGGAGACCAGCAGTT 182 NM_001076336.2
  rev GGATGTGGTGGTGGGGTGCCTCCT   
  1. dir, direction; for, forward primer; rev, reverse primer