Skip to main content

Table 1 Gene-specific primers used in SSH and semiquantitative RT-PCR analysis

From: Gene expression profiling of upregulated mRNAs in granulosa cells of bovine ovulatory follicles following stimulation with hCG

Gene   Primer Sequence (5′-3′)a GenBank accession number
ADAMTS1 Fwd CGATAAATGTGGCATCTGTGGAG NM_001101080
  Rv AGCCCACACGACTTGGAACACTC  
ADAMTS9 Fwd GGAAATCCGTATTGGGAATGCTG NM_001206573
  Rv CATCTAGCCTGCTGTACTTGGC  
ARAF Fwd TCTAACAACATCTTCCTGCACGAG NM_001014964
  Rv GGCAACTCATCAGCCTGGGTAC  
CAPN2 Fwd TGAGGGCTTCGAGGACTTCACTG NM_001103086
  Rv GCTGTCACTGGTGAGTGTGTCAG  
CRISPLD2 Fwd CTATGGGATCCTGGACGACAGG AY369781
  Rv CCTGCAAGTTCACTGCCTGACG  
CYP19A1 Fwd GTCCGAAGTTGTGCCTATTGCCAGC NM_174305
  Rv CCTCCAGCCTGTCCAGATGCTTGG  
FKBP4 Fwd TCCATTCCTCGTGAATGAATGTCC NM_001034322
  Rv TGAACCTTCAGCAACGTGCAGAG  
FKBP5 Fwd ACTGGAGCAGGCTGCCATTGTC XM_615814
  Rv CTTGAACATGTTGGCATAGATTCTG  
GAPDH Fwd TGTTCCAGTATGATTCCACCCACG NM_001034034
  Rv CTGTTGAAGTCGCAGGAGACAACC  
KITLG1 Fwd AGTAACCGTGTGACTGATGATGTG NM_174375
  Rv AGAATGCTGGCAATGCTACGGCTG  
KITLG2 Fwd AGTAACCGTGTGACTGATGATGTG NM_174375
  Rv CTAAGGGAGCTGGCTGCAACAG  
L3MBTL3 Fwd GTTATTACAGATGAGAGTGAGATGG AY437805
  Rv ACTTAAAGGACAGAAAGACGGC  
L3MBTL3 Fwd CTTACCTGGATGTGAAGAACATGG AY437805
(3’end of ORF) Rv CTGCAAGGTCTAAGACAGAGCTC  
MMP1 Fwd CTTGGACTTGCTCATTCTACTGAC NM_174112
  Rv GGCATCGATGCTCTTCACCGTTC  
MRO Fwd GGTGAGTTCTGAAGTCATCCATG BC146146
  Rv CCTGGTGTGCCGACCACCTTC  
NUDT10 Fwd GACAGGTGAGCTCTTTCACACTC NM_001035488
  Rv GGAGTTATGTCTAGAGGCACAGTC  
NUDT11 Fwd GAACAGCAAAGATGTCCAGGATTG NM_001101296
  Rv CACACACATGGTGCCTGGAGAG  
P4HA3 Fwd TTGGCAAGGTGGCCTATGACATG NM_001001598
  Rv CTGGAGCAGCAGGTAAGGACTG  
POSTN Fwd CCAAAGCCCACTGCCAGTTCTC AY445072
  Rv GAAAGCCACTTTGATGTGAAGAATGAG  
PSAP Fwd CTTCCTCCTGTACCCTCAGGAC NM_174161
  Rv GGGATGACGTTCTCTGAGACCAC  
PTGS2 Fwd GCATTCTTTGCCCAGCACTTCACCC NM_174445
  Rv CTATCAGGATTAGCCTGCTTGTCTGG  
RBP1 Fwd CGGTCGACTTTACCGGGTACTG NM_001025343
  Rv GTCATGTCACTCATTCCTAGAGAC  
SDC4 Fwd TCCGAGAAACTGAGGTCATCGAC XM_584869
  Rv GGTACACCAGCAGCAGCACGAG  
TIMP1 Fwd CGTCATCAGGGCCAAGTTCGTG NM_174471
  Rv GCAAGGACTGCCAGGTGCACAG  
TIMP2 Fwd TGCAATGCAGACATAGTGATCAGG NM_174472
  Rv CGCTTCTCTTGATGCAGGCGAAG  
TNC Fwd CTATGTGCCCATTGCAGGAGGTG NM_001078026
  Rv AACTTGGTGGTGATGGTTGAGCTC  
USP53 Fwd GAGAGCATACCCACCAGTCAGATG BC149007
  Rv GTTACTTTGACATCAGGAGTAGAGTC  
  1. Fwd foward primer, Rv Reverse primer
  2. aAll primers were designed and validated by the authors