Skip to main content

Table 1 Primers used for qRT-PCR for ChIP and DNase sensitivity assays

From: Chromatin status and transcription factor binding to gonadotropin promoters in gonadotrope cell lines

Primer Product length Chrom-osome Localization
Name Sequence (5′-3′) Start End
Actb-F GGCCAGCGTTTGCCTTTTATGGTAATAAT 181 5 142,905,689 142,905,869
Actb-R CGAACTATCAAGACACAAAAGAAGGCTATA
Fshb-F GGTGTGCTGCCATATCAGATTCGG 280 2 107,059,594 107,059,873
Fshb-R GCATCAAGTGCTGCTACTCACCTGTG
Gnrh-F CAGCAGGTGTTGCAATTACATTCACCATTAAG 227 14 67,745,100 67,745,326
Gnrh-R CCTGTTTGGATGTGAAAGTCAAAGGGATCTC
Cga-F GAAAATGGCCAAATGCTCTC 193 4 34,893,533 34,893,725
Cga-R TGTTCCCAGCTGCACATAAG
Lhb-F CGAGTGTGAGGCCAATTCACTGG 218 7 45,420,767 45,420,984
Lhb-R GGGCCCTACCATCTTACCTGGAGC
Gnrhr-F ATCAGAAGTAACAGGGACTCCACTC 202 5 86,197,672 86,197,873
Gnrhr-R AGGCAGTAGAGAGTAGGAAAAGGAAG
  1. Localization and product length (bp) from the UCSC Genome Browser using the Mouse Dec. 2011 (GRCm38/mm10) Assembly.
\