Skip to main content

Table 1 List of primers used for transcript quantification by qPCR

From: Oleic acid induces down-regulation of the granulosa cell identity marker FOXL2, and up-regulation of the Sertoli cell marker SOX9 in bovine granulosa cells

Name Sequence Size (bp) NCBI accession no.
ESR2 Forward GGTCAATCCATCCTACCCCT 264 NM_174051.3
ESR2 Reverse TTCACGCCAAGGACTCTTTT
FOXL2 Forward AGCCAAGTTCCCGTTCTACG 140 NM_001031750.1
FOXL2 Reverse GGTCCAGCGTCCAGTAGTTG
FST Forward GCACTGGCCGCCTGAGCACCT 191 NM_175801
FST Reverse TGGGGCACAGACGCAGCGGG
PPARG forward TATCCCCGGCTTTGTGAACC 288 NM_181024.2
PPARG Reverse GGGCGGTCTCCACTGAGAAT
PTGS2 Forward TACAGCACTTGAGTGGCTATCAC 317 NM_174445
PTGS2 Reverse CTGGTCAATTGAAGCCTTTGATAC
SOX9 Forward ACCTGGAACTTCAGTGGCG 147 XM_010816647.1
SOX9 Reverse CCAAGTAGGGGAAGGCGAAT
TBP Forward GCCTTGTGCTTACCCACCAACAGTTC 200 NM_001075742.1
TBP Reverse TGTCTTCCTGAAACCCTTCAGAATAGGG