Skip to main content

Table 1 Oligonucleotide sequences of primers used for RT-qPCR analysis

From: Expression of genes associated with BMP signaling pathway in porcine oocytes before and after IVM – a microarray approach

Transcript Sequence (5′-3′ direction) Gene accession no. Product size (bp) Efficiency
CHRDL1 AACAATGCCTGTGTATGAGT
TCTGGGCTTCTCCTTCAGT
XM_005673817.2 242 91%
FST GAGCCCACCTCCTCAGGAC
TCTCAGGGCACAGCTCATCG
NM_001003662.1 238 94%
TGFβR3 TGATCCACCATGAAGTGCAGT
TGCCTTCCTGCGCTGTCTC
NM_214272.1 190 108%
ID1 AGCTGAACTCGGAATCCCAA
TTCAGCGACACAAGATGCGAT
NM_001244700.1 147 107%
SMAD4 CCAAGTGCATATATAAAGGTCT
AGCCTTTCACAAAACTCATCC
XM_013985326 235 98%
PBGD GAGAGTGCCCCTATGATGCT
ATGATGGCACTGAACTCCT
NM_001097412.1 214 bp 97%
B-ACTIN GGGAGATCGTGCGGGACAT
CGTTGCCGATGGTGATGAC
DQ845171 141 bp 99%
18S rRNA GTGAAACTGCGAATGGCTC
CCGTCGGCATGTATTAGCT
AB117609 105 bp 97%