Skip to main content

Table 1 Sequences and sizes of all tested genes

From: ACTH-induced stress in weaned sows impairs LH receptor expression and steroidogenesis capacity in the ovary

Gene Reference sequence Primer sequence (5’-3’) Size
LHR NM-214449.1 sense GCTCACCCAAGACACTCC 190
antisense CACATGAGGAAACGAGGC
StAR NM-213755.2 sense GGCAAGGCTCTTCTAACT 99
antisense TAGACACGAAAGGGCTCA
P450scc NM-214427.11 sense CCAGCATTACCAGAAGCC 92
antisense GAGCCATTACCTCCGTGT
P450arom NM-214429.1 sense AAGAAGGGTCACAACAAG 165
antisense AAGAAAGCCAGTGAGCAG
P450c17 NM-214428.1 sense ATGATCCAAGCCAAGACG 140
antisense TTTACCACAGAGGCAGAAG
3β-HSD NM-001004049.1 sense CCTGGCAAGTATTTCTCGG 107
antisense CCAGCAACAAGTGGACGAT
β-actin NM-001167795.1 sense CTCCATCATGAAGTGCGACGT 114
antisense GTGATCTCCTTCTGCATCCTGTC