Skip to main content

Table 1 Primers list used in RT-qPCR

From: Modulation of gonadotrophin induced steroidogenic enzymes in granulosa cells by d-chiroinositol

Gene Protein name Sequence 5′- 3′ Amplicon lenght (bp) NCBI Ref. sequence
RpS7 Ribosomal protein S7 F: AATCTTTGTTCCCGTTCCTCA 135 NM_001011.3
R: CGAGTTGGCTTAGGCAGAA
β3 integrin β3 integrin F: GACAAGGGCTCTGGAGACAG 233 NM_000212.2
R: ACTGGTGAGCTTTCGCATCT
IGF1R Insulin-like growth factor 1 receptor F: CGTGGGAGGGTTGGTGATTA 161 NM_000875.3
R: TGGCCACTCTGGTTTCAGGT
CYP19A1 Aromatase F: CCCTTCTGCGTCGTGTCAT 86 NM_000103.3
R: GATTTTAACCACGATAGCACTTTCG
P450scc (CYP11A1) Cholesterol side-chain cleavage enzyme F: ACCAAGAACTTTTTGCCCCT 127 NM_000781.2
R: ATGTCCCCCGAGTAATTTCC