Skip to main content

Table 1 Primer sequences for various transcripts used in the study

From: Very small embryonic-like stem cells (VSELs) detected in azoospermic testicular biopsies of adult survivors of childhood cancer

Primer Sequence Annealing
Oct-4A F
R
CTCCTGGAGGGCCAGGAATC
CCACATCGGCCTGTGTATAT
62 °C
Oct-4B F
R
GCTTCTGAGACATGATGCTCTTCC
CTCACTCAAGTATCACCCCCAGT
62 °C
Nanog F
R
AGTCCCAAAGGCAAACAACCCACTTC
TGCTGGAGGCTGAGGTATTTCTGTCTC
62 °C
Sox-2 F
R
GGGGGAAAGTAGTTTGCTGCCTCT
TGCCGCCGCCGATGATTGTT
62 °C
Boule F
R
CAGTGCCGCAACTTGCT
GGCACTTGTTGGGTTATTCAAAGG
55 °C
18S F
R
GGAGAGGGAGCCTGAGAAAC
CCTCCAATGGATCCTCGTTA
61 °C