Skip to main content

Table 1 Primer sequences

From: Placental lipase expression in pregnancies complicated by preeclampsia: a case–control study

Gene name Forward primer Reverse primer
LPL 5′-TGGATCGCTCCACTTTGACC 5′-GGGCTTCGGACTGGTAAACA
LPIG 5′-GTCCAGCCCCTGCTATCTCA 5′-CCTTTTCAAACTGACCCTTGCC
LIPE 5′-CACATTAGACCCAGAAGATGCC 5′-GGCAGCGAAACTTGACAGTG
PNPLA2 5′-TGCCCACTTTGTGTGTATGTG 5′-CCAGGAGTGCGACGCT
CK7 5′- CCGTGCGCTCTGCCTATGGGG 5′- GCTCCAGAAACCGCACCTTGTCGAT
CD34 5′- CCACAGGAGAAAGGCTGGGCGA 5′- AGCCCCTCGGTTCACACTGGC
DES 5′- TCCGAGAAACCAGCCCTGAGCAA 5′- GTGGCCTCACTGACGACCTCCC
TBP 5′-GGGCACCACTCCACTGTAC 5′-CTGTTCTTCACTCTTGGCTCCT