Skip to main content

Table 1 Summary of real-time PCR primers

From: Correlation of cumulus gene expression of GJA1, PRSS35, PTX3, and SERPINE2 with oocyte maturation, fertilization, and embryo development

Gene name GenBank accession no. Primer sequence (5′ to 3′) Product size (bp)
GJA1 NM_000165 Fa: AGCAGTCTGCCTTTCGTTGTAAC 94
   Rb: ACCCAGAAGCGCACATGAG  
PRSS35 NM_001170423.1 F: ATTTGCCTCTGGATTCACGG 110
   R: CGGTAAGCAGAGCTGGTTTTCT  
PTX3 NM_002852.3 F: TCCATCCCACTGAGGACCC 102
   R: TGCGCTCTCTCATCTGCG  
SERPINE2 NM_001136528 F: TCTCATTGCAAGATCATCGCC 97
   R: CCCCATGAATAACACAGCACC  
RPL19 NM_000981 F: TCGATCGCCACATGTATCACAG 93
   R: TCAGCTTGTGGATGTGTTCCA  
  1. a F, forward primer; b R, reverse primer