Skip to main content

Table 3 Gene names, primers, genbank accession numbers, annealing temperature and size of amplicons

From: Offspring subcutaneous adipose markers are sensitive to the timing of maternal gestational weight gain

Gene Primer sequence (5′-3’) Genbank Ta* Amplicon size (bp)
Accession No. (°C)
MEST (Peg-1) TGGAGGCGTGCTGTCACCCA NM_001128471 60 72
ACTGGGGTGAGACCCCGAGAG 59
LEP (Leptin) TCCAGGATGACACCAAAACCCTCA NM_213840.1 58 95
GGTGACCCTCTGTTTGGAGGAGACA 60
PPARGC1 (PGC-1α) GGCAATTGAAGAACGTCGTGT NM_213963.1 60 74
GGTCCCTCAGTTCTGTCCGT 61
CASP1 (Caspase-1; ICE; IL1BC; P45) GGAGACGACCCCCACCTTGC NM_214162 59 98
GGAGGAACCACCGCCTGGGAT 60
MCP1 (CCL2; SCYA2) GGTCCTTGCCCAGCCAGATGC NM_214214.1 60 89
TCATCAGCCGCTGCATCGAGA 58
PAI-1 (SERPINE-1) CGGACCACGGTCAAGCAGGTG NM_213910 60 147
CACCAGAACCAGGCGCGTCA 60
IL-18 ACCAGGGACATCAAGCCGTGT NM_213997.1 58 118
ACTGCCAGACCTCTAGTGAGGC 57
ACACB (ACC2) TGCCGTGTCCCTGTTTGGGC NM_001206399.1 60 126
AGGCGCACAGCACACTGCTC 60
FABP4 GCAGATGACAGGAAAGTCAAGAGCA NM_001002817.1 57 58
CCTGTACCAGGGCGCCTCCA 60
HSL (LIPE) AGTGCCTATGCTGGCGGGGA NM_214315.1 60 116
CCCAGGCGGAGGTCTCGGAA 60
LPL GTCTCGGGCCCAGCAGCATT NM_214286 59 150
GCGTGGGCTCCAAGGCTGTA 59
CD36 GCTGTGGCAGCTGTACCCCA NM_001044622 59 135
TGGATCCGGATAGCCCCACAAT 57
GLUT4 (SLC2A4) CGGCATGGGTTTCCAGTATG NM_001128433.1 60 61
CGCGAAGAGAAGGAAGACGTA 58
ATGL (PNPLA2) GGCGGAACGGCCTCCTGAAC NM_001098605.1 60 121
TTGGCTCCGGCCCTCTCCTC 60
  1. *Ta Annealing temperature°C.