Skip to main content

Table 1 Primer sequences and characteristics

From: In vivo monitoring of fetoplacental Vegfr2 gene activity in a murine pregnancy model using a Vegfr2-luc reporter gene and bioluminescent imaging

Gene GenBank Acc. #, (NCBI) Primer sequences (5'-3') Melt T (°C) Amplicon size (bp)
Vegfr2 NM_010612.2 S: CTTGCAGGGGACAGCGGGAC 59.7 314
   AS: AATCGACCCTCGGCAGGGGA 59.3  
Β-actin NM_007393.3 S: TACAATGAGCTGCGTGTGGCCC 59.7 257
   AS: AGGATGGCGTGAGGGAGAGCAT 59.5  
  1. S, Sense; AS, Anti-sense