Skip to main content

Table 1 Primer and probe sequences used in qRT-PCR for PAPPA2, PAPPA, ADAM12, E-cadherin, β-actin and GAPDH

From: Regulation of pregnancy-associated plasma protein A2 (PAPPA2) in a human placental trophoblast cell line (BeWo)

Gene Forward Primer Reverse Primer Annealing Temperature Source
PAPPA2 ACTCACCCAAGAGGGCATACATGA GCACTGAGCTGGCAAAGTAGATGT 50°C This paper
PAPPA GTCATCTTTGCCTGGAAGGGAGAA AGGGCTGTTCAACATCAGGATGAC 56°C This paper
ADAM12 CTGGGCCACAATTTCGGGATGAAT ACTGCTGAACACCATGGGAAATGG 50°C This paper
E-cadherin AGCCTCTGGATAGAGAACGCATTG GGGTGAATTCGGGCTTGTTGTCAT 50°C This paper
β-actin GCGAGAAGATGACCCAGGATC CCAGTGGTACGGCCAGAGG 60°C Knerr et al. (2005) [31]
GAPDH CGGGAAGCTTGTGATCAATGG GGCAGTGATGGCATGGACTG 56°C Kudo et al. (2003) [30]