Skip to main content

Table 2 Primers used in the study

From: Members of the murine Pate family are predominantly expressed in the epididymis in a segment-specific fashion and regulated by androgens and other testicular factors

Primer TM(°C) Sequence
Pate-A F1 55 ACTGACCGTCCTGAGCACTT
Pate-A R1 55 TAGCTTGGACTGTGTGTGAGA
Pate-B F1 59 AATCAGCACACTGCTCATCG
Pate-B R1 59 CGAGCACATTTGCTTTGAGT
Pate-C F1 55 TCCTGAGGCTGTGTCTCTTTC
Pate-C R1 55 TTCGTGCACTTAGTCTCAGCA
Pate-C R2 55 TCCAGATCTTTCTTCTGTGACG
Pate-C F3 59 TGTATGATCCGCAGAACCTG
Pate-C R3 59 AAGGAAAGGGCTGATGAGGT
Pate-DJ F1 58 TGTGTAACATGCCACCTTCG
Pate-DJ R1 58 TGATAACTGGAGAGAGCCACTG
Pate-E F1 62 AGCTGAGCATCGTTCTGCTA
Pate-E R1 62 GGCATCTAGAGTATGCATCATTTG
Pate-H F1 59 CCGGTGACAAAAATCAGTACA
Pate-H R1 59 TGGAACCCATACATGAACCTG
Pate-M F1 59 GACAAGGGTTGCAGGATGTT
Pate-M R1 59 CAGCGCAGGTCTGTCTATGA
Pate-M F2 59 GAGCCATTCATGCAAAACCT
Pate-M R2 59 CGATGATCAATCCGTGAAGT
Pate-M F3 57 ACCTGGAGGCAGGACTCATA
Pate-M R3 57 GTGGACGTGTCTGTGGAGAA
Pate-N F1 55 GTCTCATTCAATGGGGGAAC
Pate-N R1 55 TAGCTTTCATTGCAGCAGGA
Pate-P F1 59 CTTTGCTGGTGATGTCCCTG
Pate-P R1 59 CTGTCTTATCTCCAATCATA
Pate-Q F1 59 TCCTGTCTTTGCTGGTGATG
Pate-Q R1 59 GAGCACCCAACAACATATGAAA
Pate-X F1 55 GGATGTAGGAGAAAGAGTGCTGA
Pate-X R1 55 CAGGTGCACAGGGTTTACAA
Pate-X F2 57 GTCAGAAGGAGGCCCAATTA
Pate F1 59 GATGCCTCTATCTTTCTGTGC
Pate R1 59 TCCTCTTCCTCTGGTGCAAT
Acrv1 F1 55 GACGAAGCAGGTGAACAGGT
Acrv1 R1 55 ACCCTTGAACCATGAACTGG
Sslp1 F1 55 ACTCTTGGGCATCTTTTTGC
Sslp1 R1 55 AGACATCCCTGGAAGCCATA