Skip to main content

Table 1 Primers used for quantitative real-time PCR analysis

From: Improved blastocyst development of single cow OPU-derived presumptive zygotes by group culture with agarose-embedded helper embryos

Gene name GeneBank accession number Forward primer (5'-3') Reverse primer (5'-3') Product length (base pairs)
AKR1B1 BT021058 TGCAACCCAAATACTCTTTT AAAAGCCTAGCTGAAAGGAT 106
ATP5A1 M_174684.2N GACCGATGGAAAGATCTCAG AACCACCAAGCAACATGG 212
CD9 NM_173900 AGATCTTCCGAAGCAAATTC CAAAGTTAGTGGCAAAGGAA 238
ODC1 NM_174130.2 CTATGTGATGTCAGGGCCAA CACGTTAATACGCGTGGAAG 166
PGSH2 NM_174445 ATCCTCCCACAGTCAAAGAT GCACATCACACACTCTGTTG 162
PLAC8 NM_001025325 TCTGACATTTTTACCGCTCT ATTTCATTGCAGCATTTTCT 131
PLAU NM_174147.2 ATCCCTCTGACTATCGCTAC CAGGAATCTGTTTCCCACTG 151
TGFβ1 NM_001166068.1 TGGAGCTGTACCAGAAATATAGCAA GCCACTGCCGCACAACTC 120
TXN AF104105 TGATCAAGCCTTTCTTTCAT TAATGGTGGCTTCAAGTTTT 195
  1. AKR1B1: aldo-keto reductase family 1, member B1; ATP5A1: alpha subunit ATP synthase isoform 5 A1; CD9: CD9 molecule; ODC1: ornithine decarboxylase; PLAU: urokinase-type plasminogen activators; PGSH2: prostaglandin G/H synthase-2; PLAC8: placenta-specific 8; TGFβ1: transforming growth factor beta 1; TXN: thioredoxin.
  2. Primer sequences for 18s ribosomal RNA (18srRNA), beta actin (ACTB), caspase3 (CASP3), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ) were published previously [25].