Skip to main content

Table 1 Primer and probe sequences used in qRT-PCR

From: Altered placental expression of PAPPA2 does not affect birth weight in mice

Gene Forward Primer Reverse Primer Probe (contains fluorophore, 6-FAM™, on the 5' end and quencher, BHQ-1™, at the 3' end)
PAPPA2 GGGACAAGGAAGCTCTCAGT CAGGGATCATCACAGGATTC CATGCTTGGCCACACCAACATCATGATCCA
IGFBP-5 AAAGAGCTACGGCGAGCAAA AGTAGGTCTCTTCAGCCATCTC AGACTCTCGGGAACACGAGGAACCCA
PAPPA CACAATGGACTCTGTGATGCT TCTCCCTTCTAGGCAAAGGT TGGTTCCCACCCATCGATGG
β-actin CGTGAAAAGATGACCCAGAT GGTACGACCAGAGGCATACA ACCTTCAACACCCCAGCCATGT