Skip to main content

Table 1 Primer sequences for Vascular Endothelial Growth Factor, Placental Growth factor, endothelial Nitric oxide Synthase and Hypoxia Inducible Factors

From: Tocopherol induced angiogenesis in placental vascular network in late pregnant ewes

Gene Primer Sequence 5' to 3' GenBank accession number
VEGF Forward TGTAATGACGAAAGTCTGGAG AF071015
  Reverse TCACCGCCTCGGCTTGTCACA  
PlGF Forward TGCCGGTCATGAGGCTGT NM_002632*
  Reverse GCAGTCACTGAAGAGTGTGAC  
eNOS Forward TGGGCCGCATCCAGTG NM_001129901
  Reverse GAACATCTCCTGTGCTGAGCTG  
HIF-1α Forward TCAGCTATTTGCTGTGAGG EU340260
  Reverse TTCACAAATCAGCACCAAGC  
HIF-1β Forward AGA TGC AGG AAT GGA CTT GG EU340261
  Reverse CCT GGC CTT TTA ACT TCA CG  
HIF-2α Forward AAGTCAGCCACCTGGAAGG EU340264
  Reverse TCACACACATCATGCACTGG  
HIF-2β Forward AGGATGAGGTGTGGAAATGC EU340265
  Reverse CCTCAGAGTGGCAGAACTCC  
  1. *Homology to human