Skip to main content

Table 1 Primers used for RT-PCR analysis

From: Effects of vitrification on nuclear maturation, ultrastructural changes and gene expression of canine oocytes

Gene Primers Sequence (5'-3') Tm (°C)
GAPDH Forward TGACGACATCAAGAAGGTAGTGA 61.0
  Reverse TAGCCAAATTCATTGTCATACCAG 59.4
HSP70 Forward TGCTGAGGATCATCAACGAG 60.4
  Reverse GCTTGAACTCCTCCACGAAG 62.4
SOD1 Forward AGTGGGCCTGTTGTGGTATC 62.4
  Reverse AGTCACATTGCCCAGGTCTC 62.4
BAX Forward TTTGCTTCAGGGTTTCATCC 58.4
  Reverse CTCACGGGGAGAGTCTGTGT 64.5
Bcl-2 Forward GGATGCCTTTGTGGAACTGT 60.4
  Reverse GTGGCAGGCCTACTGACTTC 64.5
Dnmt1 Forward GTGCCTCCAGGACTTCTCAG 64.5
  Reverse TCGCATGTTTGAGACTTTGC 58.4