Skip to main content

Table 1 Primer and probe sequences used for quantitative RT-PCR analysis

From: Activation of the transcription factor, nuclear factor kappa-B, during the estrous cycle and early pregnancy in the pig

Targeta Forward/Reverse Primers (5' → 3')b Fluorescent Reporterc Length of Amplicond GenBank Accession #e
TNFRSF11A GCTGACTCTGGAAGAGAAGGTGTT ATGTGCTGTCCAGACGGTGGTGGTGCCTGT 192 bp CB475057
  GCCCTGTCCACATATTCGTCTTCTGT    
TLR4 ATGGCCTTTCTCTCCTGCCTGA ATCTGAGAGCTGGGACCCTTGCGTGCAGGT 139 bp AB188301
  AGGTCCAGTATCTTGACTGATGTGGG    
NFKB1 CCCATGTAGACAGCACCACCTATGAT ACCAGGCTGGCAGCTCTCCTCAAAGCAGCA 132 bp NM_001048232
  ACAGAGGCTCAAAGTTCTCCACCA    
RELA ACATGGACTTCTCAGCCCTTCTGA ACACCTGCTCTGCCCAGAGCACTGGGTT 168 bp CN155798
  CCGAAGACATCACCCAAAGATGCT    
NFKBIA TGTGATCCTGAGCTCCGAGACTTT TCTACACCTTGCCTGTGAGCAGGGCTGCCT 143 bp NM_001005150
  TTGTAGTTGGTGGCCTGCAGAATG    
NFKBIB TCATTCTGCAGGTCCAGGTACTCA TGGATTTCCTCCTGGGCTTTGCTGCTGGCA 89 bp AK231853
  CACTTGGCGGTGATTCATCAGCAT    
  1. aThe amplification target: TNFRSF11A, Receptor activator of NFKB; TLR4, Toll-like receptor 4; NFKB1; RELA, NFKBIA and NFKBIB, Inhibitors of κB α and β, respectively.
  2. bThe forward and reverse DNA oligos used in the amplification of the target. Forward and reverse do not necessarily indicate the in vivo direction of transcription.
  3. cThe DNA oligo sequence of the dual-labeled probe (possessing the FAM reporting dye on the 5' end and the TAMRA quenching dye on the 3' end) used to measure amount of amplified target during each cycle of quantitative RT-PCR.
  4. dThe length of the amplicon created during PCR.
  5. eThe accession number to the porcine sequence that was utilized during primer and probe design.