Skip to main content

Table 1 Primer sequences and reaction conditions used in the PCR amplification of the various cDNAs

From: Short term hypothyroidism affects ovarian function in the cycling rat

Gene Sense primer (5'-3') Anti-sense primer (5'-3') Added
cDNA
(ng)
No. of
cycles
Gene bank accession N° Product size (pb) Ref.
IGF I AAAATCAGCAGTCTTCCAAC AGATCACAGCTCCGGAAGCA 50 25 [GenBank:X06108] 299 [49]
S16 TCCAAGGGTCCGCTGCAGTC CGTTCACCTTGATGAGCCCATT 100 22 [GenBank:XM_341815] 100 [50]
IGFBP3 GCCGCGGGCTCTGCGTCAACGC CTGGGACTCAGCACATTGAGGAAC 200 25 [GenBank:NM_012588] 415 [49]
IGFBP5 TTGCCTCAACGAAAAGAGC AGAATCCTTTGCGGTCACA 100 25 [GenBank:NM_012817] 377 [49]
GHR GAGGAGGTGAACACCATCTTGGGC ACCACCTGCTGGTGTAATGTC 100 25 [GenBank:J04811] 534 [50]
ERα AATTCTGACAATCGACGCCAG GTGCTTCAACATTCTCCCTCCTC 200 25 [GenBank:X061098] 344 [50]
ERβ AAAGCCAAGAGAAACGGTGGGCAT GCCAATCATGTGCACCAGTTCCT 100 25 [GenBank:U57439] 352 [50]
PRLLong AAAGTATCTTGTCCAGACTCGCTG AGCAGTTCTTCAGACTTGCCCTT 100 30 [GenBank:M74152] 279 [50]
IGFIR TCCACCATAGACTGGTCTCT ACGAAGCCATCTGAGTCACT 50 30 [GenBank:L29232] 433 [50]
P450arom TGCACAGGCTCGAGTATTTCC ATTTCCACAATGGGGCTGTCC 100 30 [GenBank:M33986] 271 [29]