Skip to main content

Table 1 Oligonucleotides and experimental parameters for QPCR, and oligonucleotides for in situ hydridization probe synthesis, for experiments in mouse fetal lungs

From: Expression of genes related to the hypothalamic-pituitary-adrenal axis in murine fetal lungs in late gestation

Genesa(NCBI) Oligonucleotidesb Amplicon length (bp) QPCR conditionsc
  QPCR: forward/reverse RNA probes: forward /reverse Probe position Ann. T°C Acq. T°C # of cycles
  Target genes
Pomc (NM_008895) CATTAGGCTTGGAGCAGGTC/TCTTGATGATGGCGTTCTTG 174 66 88 45
  ACGTGGAAGATGCCGAGATTCTGCTACAGTC/CAGGAACAGCAGCAGTGC 141-433    
Mc2r (NM_008560) CCTCTCTTTGCTGGGCTCTA/GCACCCTTCATGTTGGTTCT 321 63 83 40
  CCTCTCTTTGCTGGGCTCTA/GCACCCTTCATGTTGGTTCT 589-909    
Crh (NM_205769) CCTGGGGAATCTCAACAGAA/AACACGCGGAAAAAGTTAGC 120 62 89 45
  TCCGCATGGGTGAAGAATAC/GGTGGAAGGTGAGATCCAGA 347-649    
Crhbp (NM_198408) TCTTACCAGAAGGAGCATCAG/GTGTCCGAGGGTAAGATCAG 241 63 81 45
  CGGGGATTTCCTGAAGGTAT/CTGCAGTTTTGGTGCTGGTA 469-768    
Crhr1 (NM_007762) CCAGGATCAGCAGTGTGAGA/TGTTGTAGCGGACACCGTAG 161 64 86 43
  CCAGGATCAGCAGTGTGAGA/AGTGGCCCAGGTAGTTGATG 265-372    
Crhr2b (NM_009953) CAGGCCAGGCACCCCAGGAC/GGAACCACGCGATGTTTCTCAG 477 68 85 43
  GGCTTTACCTTGGTGGGTAG/TGAAAAATTCCCAGTTGTGGTC 162-492    
Nr3c1 (NM_008173) GGGGAATTCACAGACTTTCGGCTTCTGGA/GGGAAGCTTCTGACCTCCAAGGACTCTCG 297 63 83 40
  ACCTGGATGACCAAATGACC/AGGAGAGAAGCAGTAAGGTTTTCA 1821-2078    
Mrap (NM_029844) TTCGTGGTGCTCCTCTTTCT/TCCTGGCTCCTCTGTTGTCT 162 63 85 43
Cyp21a1 (NM_009995) CCTTGCCCCATCGTGCAACTA/TGGAGGCAGCAGAGTGAAGG 278 67 85 43
Vim (NM_011701) GATCAGCTCACCAACGACAA/AAGACGTGCCAGAGAAGCAT 170 62 84 40
Krt18 (NM_010664) GTGGAATCCAGACCGAGAAA/GTTCTTCCTTGAGTGCCTCG 406 58 84 40
  Housekeeping genes
Gapdh (NM_008084) GTCGGTGTGAACGGATTTG/AAGATGGTGATGGGCTTCC 215 61 84 40
Hprt1 (NM_013556) AGTCCCAGCGTCGTGATTAG/AATCCAGCAGGTCAGCAAAG 228 64 82 40
Sdha (BC031849) ACACAGACCTGGTGGAGACC/CAAACGGCTTCTTCTGCTGT 179 59 84 45
  1. aPomc, proopiomelanocortin; Mc2r, melanocortin receptor 2 (ACTH receptor); Crh, corticotropin releasing hormone; Crhbp, corticotropin releasing hormone binding protein; Crhr1, corticotropin releasing hormone receptor 1; Crhr2b, corticotropin releasing hormone receptor 2β; Nr3c1, nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor); Mrap, melanocortin2 receptor accessory protein; Cyp21a1, 21-hydroxylase; Vim, vimentin; Krt18, keratin 18; Gapdh, glyceraldehyde-3-phosphate dehydrogenase; Hprt1, hypoxanthine phosphoribosyltransferase 1; Sdha, succinate dehydrogenase complex, subunit A, flavoprotein.
  2. bPrimer pairs used in QPCR experiments are presented. Primer pairs used to amplify and clone specific fragments to be used in RNA probe synthesis are underlined. Primer pairs for cloning contain sequences for restriction endonucleases: forward primers, GGGGAATTC; reverse primers, GGGAAGCTT.
  3. cAnn. T°C = annealing temperature; Acq. T°C = acquisition (fluorescence intensity reading) temperature.