Skip to main content

Table 2 PCR and RT-PCR primers

From: Syndecan-1 knock-down in decidualized human endometrial stromal cells leads to significant changes in cytokine and angiogenic factor expression patterns

  sequences 5' 3' size of the amplified fragment [bp]
β-actin for - cagggtgtgatggtgggaatgg
rev - caggatggcgtgagggagagca
409
IGFBP-1 for - agtttagccaaggcacagga
rev - tatctggcagttggggtctc
204
PRL for - gcttctgtatcatctggtcacg
rev - tgcgtaggcagtggagcag
247
GAPDH for - tgcaccaactgcttagc
rev - acagtcttctgggtggcagtg
131
  1. Primers for amplification with PCR and RT-PCR