Skip to main content

Table 1 Nucleotide sequences of PCR primers.

From: Rapidly evolving marmoset MSMB genes are differently expressed in the male genital tract

Primer name Primer sequence (5' to 3' orientation) Gene Size (bp)
mspAs1F TCATGCTATTTAATACCCAATAAGATG MSMB1 140
mspAs1R ATTTCTTTTTCGAGGCAATCACATTCA MSMB1  
mspEs1F ATGGATCATGCTATGTAATACGTCATA MSMB2 160
mspEs1R AGGGAGCAACATGATATTTCTATGTCA MSMB2  
mspJs1F CATCATGCTATTTAATACTGAATGACG MSMB3 149
mspJs1R ACATGATATTTCTTTTTCTTGGCAAGT MSMB3  
mspBs1F CATCATGCTATTTAATACTGAATGACA MSMB4 154
mspBs1R GTGCAACATGATATTTCTTTTTCGCCA MSMB4  
mspAs2F AAGGTGGCAGACTGAGAACTGTGATGA MSMB1 144
mspAs2R ACCACAATATACTTGCAGTCCTCTTGC MSMB1  
mspEs2F CTGTGAGCTATGTGCTTGCCGTGACAT MSMB2 189
mspEs2R CTAGAAGCACATTACGATATCCATCCA MSMB2  
mspJs2F AAAGTGGCGGACTGACAGCTGTGACAT MSMB3 152
mspJs2R TCTTCTCCACCACAGTTAACTTGCACT MSMB3  
mspBs2F CTGACAACTGTGAGACATGTGCTTGTG MSMB4 196
mspBs2R CTAGAAGCACATTACGATATCCATCCG MSMB4  
GAPDHF AAAGTGGATGTCGTCGCCATCAATGAT GAPDH 156
GAPDHR CTGGAAGATGGTGATGGGATTTCCATT GAPDH  
CTSBF AGAAGTTCCCCGTGTTCGAGGCTGTGT CTSB 126
CTSBR GAGGGAGACTTTGGAATACTCGCAAGT CTSB  
  1. Primers belonging to primer set 1 or 2 contain the designation s1 or s2 in their name respectively. The last letter in the primer names indicate whether the oligonucleotide is priming on the coding (F) or complementary (R) strand. Size, refers to the molecular size of the expected PCR product.