Skip to main content

Table 1 Oligonucleotide primer sequences.

From: Expression of genes associated with immunity in the endometrium of cattle with disparate postpartum uterine disease and fertility

Gene   Primer sequence Size Tm (°C) Accession No.
CD45 Sense CTCGATGTTAAGCGAGAGGAAT 185 56 AJ400864
  Anti sense TCTTCATCTTCCACGCAGTCTA    
CD14 Sense GGGTACTCTCTGCTCAAGGAAC 199 56 NM_174008
  Anti sense CTTGGGCAATGTTCAGCAC    
MD-2 Sense GGGAAGCCGTGGAATACTCTAT 204 54 DQ319076
  Anti sense CCCCTGAAGGAGAATTGTATTG    
NOD1 Sense GTCACTCACATCCGAAACACTC 213 55 XM_598513
  Anti sense CCTGAGATCCACATAAGCGTCT    
IL1A Sense AGAGGATTCTCAGCTTCCTGTG 224 54 NM_174092
  Anti sense ATTTTTCTTGCTTTGTGGCAAT    
IL1B Sense GAGGAGCATCCTTTCATTCATC 229 56 X54796
  Anti sense TTCCTCTCCTTGTACGAAGCTC    
IL1R2 Sense ATCCCATGTAAGGTGTTTCTGG 181 56 AB219098
  Anti sense TGACAGGATCAAAAATCAGTGG    
TNF Sense ACTCAGGTCCTCTTCTCAAGCC 774 56 NM_173966
  Anti sense ATGATCCCAAAGTAGACCTGCC    
IL6 Sense ATGACTTCTGCTTTCCCTACCC 180 56 NM_173923
  Anti sense GCTGCTTTCACACTCATCATTC    
IFN-a Sense AGAGCCTCCTGGACAAGCTAC 212 56 NM_001017411
  Anti sense CATGACTTCTGCTCTGACAACC    
NOS2 Sense GGACAGTAAAGACGTCTCCAGA 197 54 AF340236
  Anti sense TATGGTCAAACTTTTGGGGTTC    
IL10 Sense TACTCTGTTGCCTGGTCTTCCT 178 56 NM_174088
  Anti sense AGTAAGCTGTGCAGTTGGTCCT    
TGFBR1 Sense CAGGTTTACCATTGCTTGTTCA 243 56 NM_174621
  Anti sense TGCCATTGTCTTTATTGTCTGC    
PTGER2 Sense GTTCCACGTGTTGGTGACAG 246 56 AF539402
  Anti sense ACTCGGCGCTGGTAGAAGTA    
PTGER4 Sense TCGTGGTGCTCTGTAAATCG 226 56 AF539403
  Anti sense CTCATCGCACAGATGATGCT    
  1. Oligonucleotide primer sequences, expected amplicon size and annealing temperatures used in real-time PCR assays.