Skip to main content

Table 1 Oligodeoxynucleotide primer pairs used for PCR amplification.

From: Identification and characterization of Ca2+-activated K+ channels in granulosa cells of the human ovary

Channel subunit Alternative nomenclature Primer sequence 5' - 3' GenBank accession no. Annealing temperature Product size Source
BK β1 KCNMB1 Sense AAGGTCAGAGCCAAATTCCAAG NM_004137 57°C 80 bp ID 4758626a2
   Antisense AATAGGACGCTGGTTTCGTTC     
   Sense AGGAGGAGCTGAAGGGCAAGAAGG   57°C 309 bp Lasergene
   Antisense AGGTGGGCCAGAAGAGGGAGAAGA     
BK β2 KCNMB2 Sense AATCACACTCCTGCGCTCATACAT NM_181361 59°C 177 bp Lasergene
   Antisense TCCCCGGAAGAAGTCAGGTTA     
BK β3 KCNMB3 Sense TTGCTCGGAACAACCATTCTAAA NM_171829 57°C 155 bp ID 25952102a2
   Antisense AGACACGGGTACTTCCCCTG     
BK β4 KCNMB4 Sense GGAAAGATGAGATTGGTTCCCAG NM_014505 57°C 160 bp ID 26051275a3
   Antisense AGGACCACAATGAGAACGCC     
SK1 KCNN1 Sense AGACGTGGCTCATCTACAAACA NM_002248 59°C 149 bp ID 25777643a3
   Antisense CTGGTCGTTCAGCTTCCCTT     
SK2 KCNN2 Sense CAAGCAAACACTTTGGTGGA NM_021614 55°C 451 bp [38]
   Antisense TGTTCAGGTTCCCAGGATTC     
SK3 KCNN3 Sense CATGTTTTCGTTGGCCCTGAA NM_002249 57°C 146 bp ID 25777650a2
   Antisense GCTCGTAGGTCATGGCTATCC     
IK KCNN4 Sense TGTTCTACAAACATACTCGCAGG NM_002250 64°C 134 bp Lasergene
  SK4, KCa3.1 Antisense CATGGAGTTCACTTGTTCCCG     
  1. Primer sequences were derived from the PrimerBank (ID; http://pga.mgh.harvard.edu/primerbank; [37], from the literature, or designed using the software Lasergene (DNAStar; see source).