Skip to main content

Table 1 Designation and sequences of primers used in RT-PCR.

From: The cytoplasmic 60 kDa progesterone receptor isoform predominates in the human amniochorion and placenta at term

Primer Sequence Combinations Size (bp) Detects
pB5' CCTGAAGTTTCGGCCATACCT p15 & p35 284 B, A, C, M & S
pB3' AGCAGTCCGTGTCCTTTCT p33 & p36 396 B & A
pS GAATTCAGGAGAGTGGGTGCTC pS & p33 186 S
p15 AGGAGTTTGTCAAGCTTCAA pB5' & pB3' 197 B
p33 GAATTCATTTGGAACGCCCACTGG    
p35 CTGCAGGGACTGGATAAATGTATTC    
p36 CTGCAGGTCTACCCGCCCTATC    
gapdf AGAACATCATCCCTGCCTC gapdf & gapdr 347 GAPDH
gapdr GCCAAATTCGTTGTCATACC    
  1. Primer combinations, expected amplicon size, reaction conditions and isoforms detected are shown in Fig 2 and are described in references 26 and 33. GAPDH, Glyceraldehyde-3-phosphate dehydrogenase.