Skip to main content

Advertisement

Table 1 Primer pairs used for PCR amplification

From: Direct rosiglitazone action on steroidogenesis and proinflammatory factor production in human granulosa-lutein cells

Gene Genebank access no. Fragment length (bp) Forward primer sequence Reverse primer sequence
PPARγ NM_005037.5 161 GAGCCCAAGTTTGAGTTTGC CTGTGAGGACTCAGGGTGGT
3β-HSD NM_000198.2 196 GCCTGTTGGTGGAAGAGAAG ATGATACAGGCGGTGTGGAT
CYP11A1 NM_000781.2 200 GGAAATTACTCGGGGGACAT AACAGACGGAACAGGTCTGG
StAR NM_000349.2 157 TACGTGGCTACTCAGCATCG ACAGCAGGCTGGTCTTCAAC
CYP19A1 NM_031226.2 242 CAGAGGCCAAGAGTTTGAGG ACACTAGCAGGTGGGTTTGG
β-actin NM_001101.3 271 CTACAATGAGCTGCGTGTGGC CAGGTCCAGACGCAGGATGGC