Skip to main content

Table 2 Oligonucleotide sequences used for RT-PCR

From: Human male gamete endocrinology: 1alpha, 25-dihydroxyvitamin D3 (1,25(OH)2D3) regulates different aspects of human sperm biology and metabolism

Gene Sequence (5' - 3') Size of PCR product (bp)
VDR 5' - CTCCCCCTGCCAGTGCCTTACCTC - 3'
5' - CCCCGCTCTCCCTTCCCACACT - 3'
299
KIT 5' - AGTACATGGACATGAAACCTGG - 3'
5' - GATTCTGCTCAGACATCGTCG - 3'
780
PTPRC 5' - CAATAGCTACTACTCCATCTAAGCCA - 3'
5' - ATGTCTTATCAGGAGCAGTACATG - 3'
230