Skip to main content

Table 1 Sequences of primers and probes of target genes

From: Growth-differentiation factor-8 (GDF-8) in the uterus: its identification and functional significance in the golden hamster

Target gene Sequence
β-actin Forward: GTACCACTGGCATTGTGATGGA
Reverse: GAGAGCGTAGCCCTCATAGATG
Probe: CAGTGTGGGTGACCCC
gdf8 Forward: TGTGCTGGCAGTCCTTTCC
Reverse: GAGAAAGGCCAGTACGAATGCT
Probe: CACACCTGGGTTCTCT