Skip to main content

Advertisement

Table 2 Summary of down-regulated miRNAs that appear to be the testicular miRNAs

From: Altered microRNA expression in patients with non-obstructive azoospermia

human miRNA Mean fold-change†† Sequence (5'-3') mouse miRNA Sequence (5'-3')
hsa-let-7f -0.33 tgaggtagtagattgtatagtt let-7f TGAGGTAGTAGATTGTATAGT
hsa-let-7f-2* -0.11 ctatacagtctactgtctttcc *let-7f-1-3p CTATACAATCTATTGCCTTCCC
hsa-let-7i* -0.13 ctgcgcaagctactgccttgct *let-7i-3p CTGCGCAAGCTACTGCCTTGCT
has-miR-181a -0.21 aacattcaacgctgtcggtgagt mir-181c AACATTCAACCTGTCGGTGAGT
hsa-miR-19a -0.36 tgtgcaaatctatgcaaaactga mir-19b TGTGCAAATCCATGCAAAACTGA
hsa-miR-20b -0.44 caaagtgctcatagtgcaggtag *mir-20b CAAAGTGCTCATAGTGCAGGTA
hsa-miR-29c -0.45 tagcaccatttgaaatcggtta mir-29a(+1) TAGCACCATCTGAAATCGGTTA
hsa-miR-30a* -0.31 ctttcagtcggatgtttgcagc mir-30a-3p CTTTCAGTCGGATGTTTGCAGC
hsa-miR-30d* -0.23 ctttcagtcagatgtttgctgc mir-30a-3p CTTTCAGTCGGATGTTTGCAGC
hsa-miR-34b* -0.31 taggcagtgtcattagctgattg mir-34b TAGGCAGTGTAATTAGCTGATTG
hsa-miR-449a -0.36 tggcagtgtattgttagctggt mir-449 TGGCAGTGTATTGTTAGCTGGTTG
hsa-miR-652 -0.35 aatggcgccactagggttgtg mir-652 AATGGCGCCACTAGGGTTGTGC
hsa-miR-92a -0.30 tattgcacttgtcccggcctgt hsa-miR-92 TATTGCACTTGTCCCGGCCTG
  1. Based on expression profiles of the mouse testicular miRNAs from Ro et al. (2007) [7]
  2. ††Infertile vs. control.