Skip to main content

Advertisement

Table 1 Oligonucleotides used in this study.

From: Altered microRNA expression in patients with non-obstructive azoospermia

Primer set name Reverse transcriptase reaction primer (5' to 3') Real-time quantitative PCR primer (5' to 3')
U6 CGCTTCACGAATTTGCGTGTCAT Forward: GCTTCGGCAGCACATATACTAAAAT
Reverse: CGCTTCACGAATTTGCGTGTCAT
hsa-miR-491-3p GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGTAGAA Forward: TGCTTATGCAAGATTCCC
Reverse: TGCGTGTCGTGGAGTC
hsa-miR-302a GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCACCAA Forward: GGGGTAAGTGCTTCCATGTT
Reverse: CAGTGCGTGTCGTGGAGT
hsa-miR-520d-3p GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACCCAC Forward: GGGGAAAGTGCTTCTCTTTG
Reverse: GTGCGTGTCGTGGAGTCG
hsa-miR-383 GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAGCCAC Forward: GGGAGATCAGAAGGTGATT
Reverse: TGCGTGTCGTGGAGTC3