Skip to main content

Table 1 The sequence of the designed primers used for RT-PCR

From: Up-regulation of CatSper genes family by selenium

Gene Genebank Reverse primer Forward primer Product size
CatSper 1 AF407332 5'CACACACCGGGAATATCTTC3' 5'TCGGAGAACCACAGAGAAGAG3' 566 bp
CatSper 2 AF411816 5'TGTCAGGCTGTTGCTTTGTC3' 5'TGGCCACAGAGCAGTATTTG3' 513 bp
CatSper 3 AK014942 5'GCTCTTCCTCCTCATGTTTG3' 5'TCTTCCAACATCAGGCTCAG3' 597 bp
CatSper 4 AK077145 5'AAGGGGACACAGCAAAGATG3' 5'TATTCCAGCCATCCTTCCAG3' 417 bp
β2m NM-009735 5'TGACCGGCTTGTATGCTATC3' 5'CACATGTCTCGATCCCAGTAG3' 316 bp