Skip to main content

Table 4 Oligonucleotide primers used for real-time PCR.

From: Prostaglandin treatment is associated with a withdrawal of progesterone and androgen at the receptor level in the uterine cervix

Gene Accession No Primers
F = forward; R = reverse
Position cDNA Annealing step
PRAB NM_000926.4
[37]
F: tggaagaaatgactgcatcg
R: agcatccagtgctctcacaa
bp 2555-2574
bp 2702-2683
product: 148 bp
40 ng 56°C/15 s
PRB NM_000926.4
[37]
F: gactgagctgaaggcaaagg
R: cgaaacttcaggcaaggtgtc
bp 746-765
bp 890-870
product: 145 bp
40 ng 56°C/15 s
AR NM_000044.2 F: taccagctcaccaagctcct
R: gcttcactgggtgtggaaat
bp 3687-3706
bp 3882-3861
product: 195 bp
100 ng 56°C/20 s
Cyclophilin A NM_021130.3 F: gtggtgtttggcaaagtgaa
R: tcgagttgtccacagtcagc
bp 462-481
bp 577-558
product: 116 bp
40 ng 56°C/20 s