Skip to main content

Advertisement

Table 4 Oligonucleotide primers used for real-time PCR.

From: Prostaglandin treatment is associated with a withdrawal of progesterone and androgen at the receptor level in the uterine cervix

Gene Accession No Primers F = forward; R = reverse Position cDNA Annealing step
PRAB NM_000926.4 [37] F: tggaagaaatgactgcatcg R: agcatccagtgctctcacaa bp 2555-2574 bp 2702-2683 product: 148 bp 40 ng 56°C/15 s
PRB NM_000926.4 [37] F: gactgagctgaaggcaaagg R: cgaaacttcaggcaaggtgtc bp 746-765 bp 890-870 product: 145 bp 40 ng 56°C/15 s
AR NM_000044.2 F: taccagctcaccaagctcct R: gcttcactgggtgtggaaat bp 3687-3706 bp 3882-3861 product: 195 bp 100 ng 56°C/20 s
Cyclophilin A NM_021130.3 F: gtggtgtttggcaaagtgaa R: tcgagttgtccacagtcagc bp 462-481 bp 577-558 product: 116 bp 40 ng 56°C/20 s