Prostaglandin treatment is associated with a withdrawal of progesterone and androgen at the receptor level in the uterine cervix

Table 4 Oligonucleotide primers used for real-time PCR.

Gene	Accession No	Primers F = forward; R = reverse	Position	cDNA	Annealing step
PRAB	NM_000926.4 [37]	F: tggaagaaatgactgcatcg R: agcatccagtgctctcacaa	bp 2555-2574 bp 2702-2683 product: 148 bp	40 ng	56°C/15 s
PRB	NM_000926.4 [37]	F: gactgagctgaaggcaaagg R: cgaaacttcaggcaaggtgtc	bp 746-765 bp 890-870 product: 145 bp	40 ng	56°C/15 s
AR	NM_000044.2	F: taccagctcaccaagctcct R: gcttcactgggtgtggaaat	bp 3687-3706 bp 3882-3861 product: 195 bp	100 ng	56°C/20 s
Cyclophilin A	NM_021130.3	F: gtggtgtttggcaaagtgaa R: tcgagttgtccacagtcagc	bp 462-481 bp 577-558 product: 116 bp	40 ng	56°C/20 s