Skip to main content

Table 3 Oligonucleotide primers used for quantitative real-time RT-PCR analysis

From: Gelatinase (MMP-2 and -9) expression profiles during gestation in the bovine endometrium

Gene Primer Sequence Position
MMP-2 Forward AAAATGGATCCTGGCTTCCC 295–314
(AB043994) Reverse AATAGGCGCCCTTGAAGAAGT 415–395
  Probe TGCCTGGAACGCCATCCCTGATAA 330–353
MMP-9 Forward TCGACGTGAAGACACAGAAGGT 1925–1946
(X78324) Reverse TGATCCTGGCAGAAGTAAGCTTTC 2051–2028
  Probe CATTAGCACGCACGACATCTTTCAGTACCA 1995–2024
GAPDH Forward AAGGCCATCACCATCTT 280–296
(NM_001034034) Reverse CCACTACATACTCAGCACCAGCAT 355–332
  Probe AGCGAGATCCTGCCAACATCAAGTGG 302–327