Skip to main content

Table 2 Oligonucleotide primers used for cDNA cloning

From: Gelatinase (MMP-2 and -9) expression profiles during gestation in the bovine endometrium

Gene Primer Sequence Position
MMP-2 Forward CCACGTGACAAGCCCATGGGGCCCC 1–25
(AB043994) Reverse GCCAGCTCAGCAGCCTAGCCAGTCG 489–471
MMP-9 Forward GTGTACACCGGCGCGTCG 1786–1803
(X78324) Reverse GGGCACTTCAGGAGGTCG 2135–2118
GAPDH Forward CCTTCATTGACCTTCACTACATGGTCTA 173–200
(NM_001034034) Reverse GCTGTAGCCAAATTCATTGTCGTTACCA 1029–1003