Skip to main content

Advertisement

Table 2 PCR primer sequences

From: Diets high in selenium and isoflavones decrease androgen-regulated gene expression in healthy rat dorsolateral prostate

Gene Sequence (5' to 3')
Abcc4  
   - forward TGCTTCCCAGACTCTGCACAAC
   - reverse AAGCAAGTCGTCCATGTGTCCG
Akr1c9  
   - forward CAAGTGCCTTTGAATGCTGAGCC
   - reverse ACACCCACTTCATGCCCAAGAC
AR  
   - forward AGAAAAAATCCCACATCCTGC
   - reverse CATCATTTCAGGAAAGTCCACG
Dhcr24  
   - forward TGCTGAACTCCATTGGCTGGAC
   - reverse TTGTGGGACGATGACTCGATGC
Facl3  
   - forward TCAGGCCAAGGCAAACTCCATTC
   - reverse TGCCAAAGCAAACTGGAGGAGG
Gucy1a3  
   - forward AAGCTGAAGGCAACCTTGGAGC
   - reverse TTTGTCCTTGCCAGAGCTGCTG