Skip to main content

Table 1 Primers used in quantitative real-time RT-PCR

From: The Krüppel-like factor 9 (KLF9) network in HEC-1-A endometrial carcinoma cells suggests the carcinogenic potential of dys-regulated KLF9 expression

Gene Name Upstream Primer (5'-3') Downstream Primer (5'-3') PCR product size (bp)
18S TCTTAGCTGAGTGTCCCGCG ATCATGGCCTCAGTTCCG A 150
AKR7A2 AACTGGACACGGCCTTCATG CCTTGGTGGCAATTTTCACTCTG 109
ALDH1A1 ACCCCAGGAGTCACTCAAGG ACTGTGGGCTGGACAAAGTAG 149
BCAR3 CCTGGAAATGCCACAGATCAC CTTCATGCAGGAGTTTGCTGAA 124
C1orf186 TAGCTTGGATAGCTCCTGCAGTTC CATTTTTTAGTTCTCCAGGGTCAGA 101
CLIC4 TCACCAAAACACCCAGAATCAA ACCCCTCTCCAGTGCTTCATTA 108
COL4A1 CACGGGTACTCTTTGCTCTACGT AAGGGCATTGTGCTGAACTTG 101
COL4A2 CATGCCCTTCCTGTACTGCAA GATGTACTTGATCTCGTCCT 133
CXCR4 CATCAGTCTGGACCGCTACC GCAAAGATGAAGTCGGGAATAGTC 138
ER-α CGGCATTCTACAGGCCAAATT AGCGAGTCTCCTTGGCAGATT  
FZD5 GCTACCAGCCGTCCTTCAGT GAAGCGTTCCATGTCGATGAG 128
KLF4 CTGCGGCAAAACCTACACAAA GAATTTCCATCCACAGCCGT 106
KLF9 TGGCTGTGGGAAAGTCTATGG CTCGTCTGAGCGGGAGAACT  
LAMC2 GATGGCATTCACTGCGAGAAG TCGAGCACTAAGAGAACCTTTGG 105
LAPTM5 CATCTTTTCCATCGCCTTCATCAC TCCACCGAGTTCATGCACTTG 102
MAPKAPK3 TCCCACCCTTCTACTCCAACA TTCAACAGGAGGCGGATCA 141
NR3C1 AGAGGAGGAGCTACTGTGAAGG ACTGAGCCTTTTGGAAAATCAACC 109
PAX2 CCCAGAGTGGTGTGGACAGTTT GTAGGAAGGACGCTCAAAGACC 101
PSAT1 ACGCCTCCATGTTTCAGCAT TGAGATTTGATGGAGCTAAGCTTCT 104
PTCH1 GTCGAGCTGTTCGGCATGAT AGCAACGTGAACGGTGAACTC 111
RAB25 GGAGCTCTATGACCATGCTGAA CCAGGAAGAGCAGTCCATTGTT 125
RXRA AGGACTGCCTGATTGACAAGC GACTCCACCTCATTCTCGTTCC 141
SLPI GCTGTGGAAGGCTCTGGAAA TGCCCATGCAACACTTCAAG 298