Skip to main content

Table 1 Oligonucleotide primers used for quantitative real time PCR analysis.

From: Expression profiles for six zebrafish genes during gonadal sex differentiation

Primer Amplicon Sense primer 5'-3' Antisense primer 5'-3'
ar 242 nt AGCAGCAGCACCACTACCA TTCCTTCCTGCCTCTCGTTC
sox9a 719 nt CGGTGAAGAACGGCCAGAGC CTGTAGAGTCAGCAATGGGT
cyp19a1b 230 nt AACATTGGACGCATGCATAA TGTTTGATGGTGCTGATGGT
dmrt1a 151 nt ATGGCAGAGCAGAACGATTT TAGTCCCACAACAGCATGGA
fig α 663 nt ATGTCGTGTGAAATGACCGGC CTAGGATGGGAGTGAACTTGG
cyp19a1a 131 nt AGATGTCGAGTTAAAGATCCTGCA CGACCGGGTGAAAACGTAGA
β-actin 272 nt CCTGACCGAGAGAGGCTACA CGCAAGATTCCATACCCAAG