Skip to main content

Table 1 Primers used to amplify Tnfrsf 9 and Tnni2 from gravid d13.5 mouse uterus.

From: Identification of 9 uterine genes that are regulated during mouse pregnancy and exhibit abnormal levels in the cyclooxygenase-1 knockout mouse

Gene Direction Sequence Exons
Tnfrsf9 Forward 5'CTAGTGGGCTGTGAGAAGGT3' 3–9
  Reverse 5'TCCTCCTTCTTCTTCCTGTG3'  
Tnni2 Forward 5'GGAGACAGCACCTGAAGAGT3' 3–6
  Reverse 5'CCGTTCCTTCTCAGTGTCTT3'