Skip to main content

Table 1 Primers used for gene expression analysis by RT-PCR. Gene name abbreviation, accession number, primer sequence (forward and reverse) and annealing temperature used for gene expression analysis.

From: Testicular involution prior to sex change in gilthead seabream is characterized by a decrease in DMRT1 gene expression and by massive leukocyte infiltration

Gene Accession Number Annealing temperature Name Sequence (5'-3')
β-actin X89920 55 F ATCGTGGGGCGCCCCAGGCAC
β-actin    R CTCCTTAATGTCACGCACGATT
S18 AM490061 60 F AGGGTGTTGGCAGACGTTAC
S18    R CTTCTGCCTGTTGAGGAACC
DMRT1 AM493678 60 F GATGGACAATCCCTGACACC
DMRT1    R GGGTAGCGTGAAGGTTGGTA
M-CSFR AM050293 60 F3 CTGCCCTACAATGACAAG
M-CSFR    R4 TCAGACATCAGAGCTTCC
TCR-β AM490435 60 F1 GCTTCTTCAATGGGACAGGA
TCR-β    R1 CCGTAGACACAGCCCTTGAT
IgM-H AM493677 60 F1 CAGCCTCGAGAAGTGGAAAC
IgM-H    R1 GAGGTTGACCAGGTTGGTGT